Table 1. PCR primers and restriction enzymes used
| mRNA | Primer position | Forward primer sequence Reverse primer sequence | PCR product size (pb) | Restriction enzyme | Position of site | Fragment size (pb) |
|---|---|---|---|---|---|---|
| For each mRNA coding for the three calcium-binding proteins, the table gives the starting position of the primers in the sequence, the primer sequences (5′ to 3′), the size of the amplified product (in base pairs), the characteristic restriction enzymes used to check the specificity of the product, the position of the restriction enzyme cut site, and the size of the cut fragments (in base pairs). The compatibility of primers was assessed with the Oligo software. Note that the primers are specific for cDNA amplification and that no genomic DNA amplification was observed. (*Primers designed by Cordero-Erausquin et al. 2004). | ||||||
| Calbindin | 249 | AGGCGCGAAAGAAGGCTGGAT | 433 | EcoR1 | 173 | 260 |
| 680 | TCCCACACATTTTGATTCCCTG | 170 | ||||
| Calretinin | 157 | GCTGACGGAAATGGGTACAT* | 210 | Mbo1 | 183 | 180 |
| 367 | CAAGGAAATTCTCTTCGGTCGG* | |||||
| Parvalbumin | 171 | AAGAACCCGGATGAGGTGAAG* | 360 | EcoR1 | 187 | 190 |
| 531 | ATGGCGTCATCCGAGGGC* | 170 | ||||